KidzTube
Welcome
Login / Register

Genetics is a Piece of Cake

Thanks! Share it with your friends!

URL

You disliked this video. Thanks for the feedback!

Sorry, only registred users can create playlists.
URL


Channel: Kurtis Baute
Categories: Archeology / Paleontology   |   Biology   |   Science  
 Find Related Videos  added
78 Views

Description

Youve probably heard of genes, but how does that four-letter code translate into the physical stuff of life? To explain, I bake a cake, using a recipe written with just four letters.

Support me on Patreon! https://www.patreon.com/kurtisbaute

Im on social media!
https://twitter.com/kurtisbaute
https://www.facebook.com/scopeofscience/
https://www.reddit.com/r/scopeofscience
https://www.instagram.com/kbaute

----------------------------------------------------------------

If you want to donate to this channel, I now accept cryptocurrencies! Also, thanks!

BTC: 1NYSD5Nbxs1pD9bqnhHForXvofRphcRdF7
BCH: 1MXZVz1Sy4xTxrGHo6dQcZtsArtjWLCyp
LTC: LUKB8Xh6nrrASH9rEmymMvjhUH3f6NWJiN
ETH: 0x02032DCF55148e06C579aB0F7C9c4241cC3ce6b8

----------------------------------------------------------------

If you want to make the recipe, you should seek counciling, but here is the key and recipe:
https://imgur.com/xchdIrJ

AUGACACUACCGAGAUUUUUAGCUUUAAGGCGCGGUUCAAAGCUCUUGCGGUCAUCAUAUUUGACGGAUUUAUUACGUGAUUUGCUGUUGCUCCUCCCUGCUCUGUUGCCCGUCCUUGGCCUGCGAACUACCCGCCGUCUAUUGCUCUUAAUUCCUGCGUCGUGCUCUCGACUAACUUUGGGCCUAUUGGGGUCAACGACCGGCCCCGACACGGAUAGACUCCGCAGACUCACCAGAAGGCUUACAACUACUCGGCUAGUAGGUCUCGUCAAAAGACUUGCGGUUACAUCCGUUGAGCGUACUCCUCCUCGAGGUCUGCCCUUAUUGGUUUCGCAUGCGGAACCAAUCUACCUUGCAGCCUUGAGAUCAGGGCGAAGGUUGCCGGCCCCCGGAGCUGUAGGAACAACGCCCGCUUUACCGAGAGGGCUGACAGUACUACGGGAUGGGCGUAUCGGCCUUUACAAACUGGCGCUCCUGCUCCGCUCACGACGUUUGUGUCGGCGUCCACUGCUGCGACGCCUCCGCCGGUUAGUAUAUAGGCGCCUAUUAGCACUAACCCCAACAUCUUUGGCUAGGACAGCGCUCUUACAGCUGUCGACACCUACGCAAGGUGGACGCCGUUUAAACCUACUUUCCAGGACGUUAACGGGACGAGGCCUUUUAACGCUUCUAAAGUUGGCCGGAUUCAGGGCACGCACUAGGAUACUAGUGCUAGUUACCUUAUCUGCCCUGCUACAGUUGCUUACAACGACCACCCGACUAUUAACUCUCCAACUUCCACUUCCGCGGCGGAUCAUAUACGACCCACUCCUGGAUCUUGACCUGCUGACUCUGGACCGGAUUAAAGUGAUACCUGACACUAUCGUGGUGUUAGUGCGUACAUCCGGCAAAAAGGGCCUCGUCCGCCCACUACGGACGGCACUGUAUCGCUCUCUCCUUGGGGUAUCCUUAUCCGGUCUCUCGGAAACGCGUGGUCGAUUACGUACUCGGCUGACACGUAGGCUCUUACGGCUCCUGCUCUCGGCCCUUGGUAAGAGAGCCGAGAAGACCCUGACCCUCAAUCUGCCGAAAACUUUGCGAACCGUCGCCGAAUCGUCCGCUCUAGAGAGGUUGCUUCUUACAUUGUGGACGUUGACCCGAAGAAGGCUAGUUCUACGGAUUGUUGUAAUACCCCGCCUUUCUAGAGCACGAUCUACUUUGCCGCUUCUAGUGGCUCUACUUAGAGUCCUUAGAAUUCGUACCGUCAGGUUAUAA

----------------------------------------

This is the first cake that I've ever made the recipe had 418 steps.

Genes are the recipes that make life and we have a lot of them. If you wanted to print out all of the genetic information in an
individual on paper, you'd have to fill 67 cabinets.

We have around 20,000 genes that make proteins in our bodies. And to make that a little more palatable I want you to pretend that instead of 'genes that make proteins' were talking about 'recipes that
make cakes' I'll explain.

Just like genes, recipes evolve - the good ones get passed on. If I make a cake and it tastes good, and I give the recipe to my friend, and
if they like the recipe they might pass it on to their friends, and maybe
somewhere along the line someone modifies it and puts in more sugar and that recipe gets passed on even more.

They change and they evolve over time.

But, if I made a recipe that tasted like socks and I passed that on to my friend, well, I'd be mean and also my friend probably wouldn't pass it on. So just as with recipes, if you have genes that make you
more successful (more likely to have offspring), those genes are more
likely to get passed on.

My mom passed recipes onto me and she also passed her genes on to me, roughly half of my DNA comes from my mom and from my dad and I say roughly half because I share more DNA in common with my mom than with my dad. It isn't a perfectly even split and a lot of things get garbled up when they get passed on. It's a messy process
but it's that messiness that makes me different than anyone else.
It makes my recipes different than anyone else is.

But those differences are really small. Even though it takes a whole 67
cabinets to write out my entire genome it only takes about this much, 210 pages double sided, to print out the things that make me genetically unique. If these are all recipes then this is my special
spice.

Okay so maybe by now you get the basic idea of inheritance but genetics still seems very complicated. So in order to make it as simple as a piece of cake I'm going to make a piece of cake with a
recipe that is 418 steps. If you've ever looked for cake recipes online you probably had to sift through a bunch of other stuff, there's ads, a review, comments, notes, and buried in there somewhere is the actual recipe. Our genes are a lot like that. Most of them are actually junk and just a fraction are important instructions.

The first thing you'll probably notice about this recipe is that it's only
written with four letters: A, U, C, and G. I wrote it that way because our genetic code is also made of just four letters.

So here's how I fit 20 different ingredients and 20 different measurements into those four letters... its all in the video!

Thanks for watching!

Post your comment

Comments

Be the first to comment









RSS